“[God DNA] Proves Presence of God” says Scientists
Do You Know???
Everything We Feel, We Think, We Behave and We React, these all are possible due to the help of DNA.
Dr. Francis Collins (Director of the Genome Project) says “One can think of DNA as an instructional script for a software program sitting in the nucleus of the cell.” DNA contains all the information that makes up an organism. The quality and traits of that organism come through the guidance of DNA.
We are made from Tiny DNA. So, we can find it in every part of our body from cells to the largest body parts. It guides every chemical reaction taking place inside our body. DNA is present in the nucleus of each cell. We can find it in all living organisms such as bacteria, viruses, plants, animals, fungi, etc.
Until now, Scientists haven’t found who made DNA code. Might be God-made DNA or Nature made it through Evolution. It could be any possibility between both options.
Surely, there is a role of superintelligence behind the DNA Code. So, this complex code of DNA convinced Scientists of the presence of God. They call it “God DNA”.
Proof of God DNA
Let me make You clear about this by giving an interesting example. Suppose, You are walking by a beach and you suddenly see a message “Albert is my best friend”. And, You think this message must be written by a stick on the sand of the sea-shore. It couldn’t be written naturally by chance or through sea waves. There must be someone behind it, “an intelligence”.
Likewise, there must be someone behind such complex and extremely long DNA code, “a super intelligence” i.e. God.
DNA stands for Deoxyribonucleic Acid. The DNA that is made by unknown superintelligence i.e. God, so it is called God DNA.
It is simply the code that guides our body in everything from the development of cells to the growth, metabolism, and every activity performed in our body. It contains all the information about how the structure, how we will behave, how cells will be developed, and how cells will develop our body parts.
It is the mastermind of the design of our body. So, you can call it the “superintelligent designer” of our body.
Like computers use binary digits 0s and 1s. In the same way, DNA also uses its own language for coding. The letters which are used in DNA are A, T, G, and C.
These 4 letters of DNA code i.e. A, T, G, and C are actually the names of 4 chemicals. They are:-
Adenine
Thymine
Guanine
Cytosine
DNA code is nearly 3 billion (3,000,000,000) letters long.
Its instructions are written by different sequences and arrangements of those 4 letters.
A unique combination of these letters instructs the cell “how to carry out extremely Complex body functions?”
Amazing Facts of God DNA
Its code is transferred to the next generations and so on.
It is the reason “why a child has similar characteristics to the parents?”
A child shares 99.5% of the God DNA from parents.
It is written in 4 letters i.e. A, T, G, and C.
This DNA is nearly 3 billion (3,000,000,000) letters long.
It is found in the chromosome of the Nucleus of the Cell. Sometimes, it may be found in the mitochondria.
These sequences of 4 letters bring about the variation in organisms within the species and among different species.
It stands for DeoxyriboNucleic Acid.
It consists of 4 Nitrogen bases Adenine(A), Thymine(T), Guanine(G), and Cytosine(C).
It also contains phosphate and deoxyribose sugar.
It carries genetic information from parents to their offspring.
Example of God DNA
We know that Binary code is written through 0s and 1s. For example, 11000101101 is an instruction in the computer program.
Similarly, God DNA is written in 4 letters (A, T, G, and C). For example, AGAGTTTGATCCTGGCTCAG is an instruction in the God DNA Code.
God DNA = Natural DNA
Both the God DNA and Natural DNA are the same thing.
Natural DNA is called God DNA because Scientists haven’t found the actual superintelligence behind this Grand Design.
So, Scientists call it “God DNA”.
God DNA Structure
J.D Watson and F.H.C. Crick proposed a model of God DNA in 1953. For this excellent discovery, they were awarded with the Nobel Prize in 1962.
That God DNA Model is Helix Model.
God DNA Helix
God DNA Helix is like a spiral staircase taking a complete turn after every 34 Ao.
It has a double-stranded polynucleotide structure. In which, the 1st strand makes a helix structure with the 2nd strand.
Those Strands are joined together by a Weak Hydrogen Bond.
The Nitrogen bases form the center whereas the sugar and phosphate unit form the backbone of God DNA Helix.
The nitrogen base of God DNA remains paired and the complementary bases are found in the different strands.
One chain may have any sequence of bases but the order has to be complementary. This is called base pairing i.e. A = T and C = G.
Mutation
Mutation is an anomaly in God DNA Code.
It is also a type of variation where a sudden change occurs in hereditary characteristics.
An individual suffering from mutation is called a mutant and the agents of mutation are called mutagens.
Causes
Its Main cause is U.V. radiation and other harmful radiations like Gamma rays, Cosmic rays, etc.
It can also be caused by chemicals called Mutagens.
Sometimes, it often naturally happens during the time of God DNA Sharing when there is an anomaly (small mistake) in the God DNA Copy Process.
Examples
Six fingered man
Lack of Eyes
Cut at Lips
Birth Deaf
Birth Dumb
Extra Arm or without arm
Disability of baby by birth
One-horned sheep
4-legged chicken
Hairless variety of dogs and cats
Variation
The change in the offspring compared to their parents is known as Variation.
Causes
Environmental Variation: It is caused by environment, crossing-over in meiosis, food and habitats of animals.
Heredity Variation: It is due to the sharing of God DNA of Father and Mother to the child. In this process, new God DNA is made from a copy of half-half of Father and Mother God DNA.
Example
Height Difference
Difference in Skin Color
Hair Color Variation
FAQs about God DNA
Is DNA proof of God?
Yes of course, We can say DNA is proof of God until we find the superintelligence behind the creation of DNA.
If we assume Nature made DNA through Evolution, then there is also hidden superintelligence and it indirectly gives proof of God.
What are the four letters of DNA?
The four letters of DNA are A, T, G and C.
What does DNA look like?
DNA looks like the helix structure where genetic data is stored in the form of 4 Bases i.e. A, T, G and C.
It gives the look where 2 sugar phosphate backbone is connected with the base pair of those bases.
What DNA is made of?
The DNA is made of four nitrogen bases i.e. Adenine(A), Thymine(T), Guanine(G) and Cytosine(C). It also consists of Sugar Phosphate Backbone which supports Base pairs of those 4 Bases.
Does DNA determine your looks?
Yes Of Course, DNA determines our looks as it contains code of everything that we do, we possess, we behave and we react, etc.
Does DNA come from mother or father?
Actually DNA comes from the sharing of Father and Mothers’ DNAs where Half-Half DNA code is copied and New DNA is formed.
Are humans coded?
In my view, It’s Yes because humans are made from tiny DNA which is coded. The coded data contains the genetic sharing of the Father and Mothers’ DNA.
That’s why a child has many similar characteristics to their parents.
Why is DNA so important?
DNA is so important because it stores all the code which makes an organism and guides in everything that needs to make an organism.
Can DNA prove God’s existence?
Ummm… Might be because scientists get convinced to name it God DNA as they don’t know who is behind it.
Is it a superintelligence who created this Grand Design?
So, it proves that God exists until wwe don’t find the actual reason.
Does DNA read God eternal within the body?
Scientists call it God DNA and our whole body is made from tiny DNAs. So, we can say that our whole body is made from God Parts or we are eternal within our body.
Can God change DNA?
I would say “Yes” because if You believe in God as Nature then surely Nature can change DNA through the process of Evolution.
Is it possible to change your DNA?
Ummm… No, You cannot change your DNA.
In some rare cases, DNA gets changed a little bit by Mutation. In Mutation, DNA gets penetrated by harmful radiations like U.V. Rays and Gamma Rays, etc.
What is the code for DNA?
Actually, the code for DNA is different if you observe one organism and another organism. You will notice that their DNA pattern is different.
But also some Code Letters are used for DNA. They are A, T, G and C.
Is God’s name in our DNA?
Yes, if You assume God as Nature. Then there is God’s name in our DNA because we have come from them through Evolution.
There will be many similar DNA codes if you do a comparison of God DNA and Our DNA.
How does DNA point to god?
Does DNA Replication prove the existence of God?
Absolutely Yes, DNA Replication proves the existence of God because a new offspring gets his or her DNA by the replication or sharing of the Father and Mothers’ DNA.
As if we think God as our Primitive then surely DNA Replication proves the existence of God.
If god doesn’t exist, then who created DNA?
In My View, there is still the option that Nature created DNA.
Then, I know that You will ask “Who created Nature?”
The answer is unknown. So, You can tell a Superintelligence created it. Then also, it indirectly points towards God.
Is DNA the work of god?
Absolutely, it is the work of god if you believe in god but if you don’t believe in god then you can say that it is the work of Nature.
But also believing nature means believing unknown superintelligence. So, it indirectly points to the existence of God.
Can DNA prove the existence of an intelligent designer?
Surely Yes, DNA proves the existence of an intelligent designer because it is such a complex and extremely long Code that needs a super-intelligent designer for its Grand Design.
How did God send his DNA?
If You assume that Nature is God then Nature sent God DNA with the help of Evolution. In this process, DNA is transferred from One Generation to the Next generation with some Variation and so on.
We are now the current generation receiving God DNA.
If DNA didn’t exist, how do atheists explain that the four DNA bases prove god?
It’s simple because atheists (People who don’t believe in God) have no scientific reasons behind the creation of DNA.
As the 4 bases Adenine(A), Thymine(T), Guanine(G), and Cytosine(C) are the building blocks of any DNA of any organism.
Even when we compare the DNA of a Plant and the DNA of an Animal, we will observe that both DNAs contain the same bases i.e. A, T, G, and C.
Who else other than god can create billions of different species and trillion times trillions of unique individuals by using only four bases?
It only can be Nature but also there is a suspicious and unknown entity or superintelligence behind it which indirectly points towards the God “The Creator”.
So, we can say that Nature can create billions of different species and trillion times trillions of unique individuals by only 4 bases i.e. A, T, G, and C.
Can consciousness be linked to our DNA and explained?
Yes, Of Course, consciousness can be linked to our DNA because DNA has all the data storage for:
When will consciousness be made?
How do we become conscious?
What makes consciousness work?
How did this Complex code of DNA convince scientists of the presence of God?
As the DNA code is so long and extremely complex. So, there comes the question “How just by randomly, nature can create such a masterpiece design?”
There must be a superintelligence behind its masterpiece design. Scientists don’t even know “Who makes DNA?” So, think of some intelligent creator. Scientists get convinced of the presence of God until they wouldn’t find the secret intelligence of the DNA.
Conclusion:
Here, I have clarified: “How the Scientists Found Proof of God in DNA?”
I have explained DNA as complex code which has convinced scientists that a superintelligence exists who have created the Beautiful Grand Design of God DNA. So, Scientists simply call it “God DNA”.
Hi, I am Rama Gupta. I write articles about Space, Science, Future and Technology. I work at SpaceUpper.com since 2021. I am a student so, I keep learning something new daily which are amazing and helpful to us. I write them in the form of article which will help you to explore giant Universe of Science and Technology.
